0
What else can I help you with?
Related Questions
Which is better Samsung corby or Samsung B3410?
i prefer the samsung b3410! :):)
Is the Samsung b3410 touch screen?
Yes, the Samsung B3410 has Hybrid Touch & QWERTY layout.
Why cant I get on the internet on my Samsung b3410?
This is because the samsung b3410 does not have wifi, which is the wireless Internet from the area.
Does Samsung b3410 have wifi?
raphael
How do in restore contacts on a Samsung B3410?
8793339089
Is Samsung b3410 an android?
No, this phone isn't an android
What is the operating system of Samsung Corby B3410?
TouchWiz
Does the Samsung b3410 have a signature for texting?
Samsung brand doesn't have signitures for all of their phones.
WHAT IS the Default password for samsung gt b3410?
Default is usually the last 4 digits of your phone number.
How much does the Samsung B3410 mobile phone cost in Ireland?
thoughtful
How do you record a voice mail answer message on your Samsung B3410?
it dapends on the password that you put :P
Where can you download free games for your Samsung Gt-B3410?
I think that there is no compatible game for this mobile.
Trending Questions
When did alcohol first occur?
How long can a rowan tree survive?
What does a decapitated rabbit mean?
What is the opinion that ones own way of life is natural or correct and the only true way of being fully human is called?
Id like to teach the world to sing in perfect harmony id like to buy the world a coke and keep it company?
How do you convert 21.1 meter squared to liters?
What is the fear of tetanus called?
What word mean without difficulty or much effort?
What is 4 divide by 592?
Does apple juice contain calcium?
Zeppo Marx of all people is believed to have been the first to bring this breed also known as the Persian greyhound to the US What is it?
How old is Leo Valdez in The Lost Hero?
Does the mandible on a grasshopper open side to side or top to bottom?
Why is Play-Doh named that?
Why does America have the highest number of serial killers?
Does a metal spoon melt with heat?
Where are the Bank 1 Sensor 2 located in a 1998 Jeep Grand Cherokee?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What is the number of seconds in 10 weeks in scientific notation?
What is the penultimate letter of the English alphabet?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.