answersLogoWhite

0

How do you write 5 tablespoons?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/20/2019

You write '5 tbsp'.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

How many tablespoons is 75g plain flour?

That is 5 tablespoons


How many tablespoons is 75ml of water?

There are 5 tablespoons in 75mL. Each tablespoon is 15mL.


Tablespoons in 5 pints?

160 tablespoons


How many Tablespoons is 5 ounces of water?

That is approximately 10 tablespoons


120 grams of butter in tablespoons?

5 tablespoons


How may cups are in 5 tablespoons?

5 US tablespoons = 0.3125 US cups


What does 5 tablespoons equal in milliliters?

5 measuring tablespoons equal 75 ml.


5 tablespoons equals how many ml?

5 tablespoons is 75 ml of water or similar liquid.


How may tablespoons in 75ml oil?

That is approximately 5 tablespoons


How many tablespoons in 5oz?

There are 2 tablespoons per fluid ounce so 2 x 5 = 10 tablespoons in 5 fluid ounces.


80 mls is how many tablespoons?

5 and 1/3 metric tablespoons


How much is 5 tablespoons equal?

5 tablespoons is approximately 2.5 ounces.

Trending Questions
Will an electron experience its own field? What is the most difficult genre of music to make? What is a palindrome for fly alone? What are the 9 Fielding positions of softball? Do butterflys have legs? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? How thick does a concrete shelter need to be to protect from fallout? Are Laura Dern and Bruce Dern related? What is tagalog meaning of honesty? Which of the worlds highest peaks stand apart from the mountain ranges labeled on this map? What is the formula for calculating the molality (m) of a solution? What term is given to 10 to the power of 7 eg 10 to the power of 6 is mega? What is the area of a rectangle 15 feet and 1000 feet wide? What is the governors job? I am 5 foot and i weigh 97 pounds and I'm 21 years I'm very petite I'm you anorexic? Where is the fuel pump relay located on a 1997 Ford F-150? What were the conditions for prisoners of war in World War 2? How do you say Kamryn in French? In a fraction what is the numerator? Why is Atlanta called hotlanta?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.