0
What else can I help you with?
Related Questions
Does piggy die at the end or the beginning of lord of the flies?
Piggy dies near the end of the book.
Who picks on Piggy in Lord of the Flies?
Jack
Who is punched by jack in Lord of the Flies?
Piggy
How is Prometheus connected to Piggy in lord of the flies?
It is not.
Who is on the newest cover of Lord of the Flies?
piggy
Who is the intelligent boy in the Lord of the Flies?
piggy
Which character has asthma Lord of the Flies?
piggy
How was piggy handicaped lord of flies?
asthma
Who finds the conch in "Lord of the Flies"?
In "Lord of the Flies," the character named Piggy finds the conch.
Who finds piggy spectacles in Lord of the Flies?
Piggy finds the spectacles in Lord of the Flies. He uses them to start the signal fire and later relies on them to see clearly.
What disease does piggy have in lord of the flies?
Piggy in "Lord of the Flies" does not have a specific disease. He is portrayed as overweight, asthmatic, and socially awkward, but his character does not explicitly have a mentioned disease.
What doesn't piggy's hair do in lord of the flies?
piggy's hair doesn't seem to grow
Trending Questions
How do you Replace ignition coils in Ford Expedition?
What materials are needed to wallpaper two rooms in my home?
When selling girl scout cookies do people pay you straight away?
Fidelity Investments vs. Fidelity National Financial?
what did congress create election day in hope of ?
Can verbal abuse be used in court against parents?
What is the song played in tropic thunder after the guys finished the ambush scene?
How do you reset oil life on my 2009 Chevy Malibu?
Why do ponies stick their bum up and legs stretched out?
Video how to replace fuelpump for 2002 Pontiac sunfire?
How do you do web check in online for Indigo Flights?
What is a devise that converts electrical energy into mechanical energy?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What continent is 20 south and 20 east?
Is matchstick is a conductor?
Can a 99 civic front end fit on a 97 civic?
What channel is lifetime on if you haveRodgers?
How to spell numbers 1-31?
How do you remove a 1.5 inch by 2 feet vertical dent from a steel garage door?
Disadvantages of oil consumption?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.