0
What else can I help you with?
Related Questions
How long doe the moon take to revolve around the earth?
come do sex
What is the sex of a doe?
A doe is a female deer
How long doe jaundice last?
If untreated, until you die.
How long does sex intercourse can last?
Sex can last a period of time depending on the two sex mate
How long does sex go for?
about a week..... if you last that long
What doe it mean to bang a girl?
to have sex with
How long sex need to be last?
2 or 4 min
What is the best direction in sex?
if I knew it so why doe i search for it
How long does average sex last for?
What I heard is that the span of sex in America for people over 30 is 15 to 20 minute's.
How long do ice burgs last for?
till u sex til they break
How long does sex needs to happen?
Try better grammar and asking a more specific question. Your current question does not specify how long would sex need to last for ______ to occur. If you are trying to ask how long does it have to last for in order for it to be considered sexual intercourse, the answer is open to opinion but generally even momentary penetration will be considered sex.
Is it good to have make up sex right after every argument and will it last like that?
no and no not for long
Trending Questions
Should I have my car wrapped?
Why does light have a dual wave particle model?
What does the carrying of seeds to a new place?
What was F. Scott Fitzgerald's daughter's name?
What is the lecithin daily intake?
What did suyuan woo tell an-mei when an-mei prepared for her trip to china?
What cranial nerve is used for pupillary constriction?
Can you use August in a sentence please?
How many electrons in one columb?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the significance of the spiritual rosary in the practice of prayer and meditation?
How many votes does each state have in the electorial college?
What is the closest airport to Osage Beach MO?
How do you remove center console from 2004 Hyundai xg350?
Is the Grand National cruel?
What are symptoms of chiari malformation?
What is the most poinsonous land snake?
How do you integrate e powerintegral2x-1?
Deciduous trees are those that?
What is the US Mining Law of 1812?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.