answersLogoWhite

0

How long doe sex last for?

User Avatar

Anonymous

∙ 15y ago

it last from 10 min to 15 min

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

How long doe the moon take to revolve around the earth?

come do sex


What is the sex of a doe?

A doe is a female deer


How long doe jaundice last?

If untreated, until you die.


How long does sex intercourse can last?

Sex can last a period of time depending on the two sex mate


How long does sex go for?

about a week..... if you last that long


What doe it mean to bang a girl?

to have sex with


How long sex need to be last?

2 or 4 min


What is the best direction in sex?

if I knew it so why doe i search for it


How long does average sex last for?

What I heard is that the span of sex in America for people over 30 is 15 to 20 minute's.


How long do ice burgs last for?

till u sex til they break


How long does sex needs to happen?

Try better grammar and asking a more specific question. Your current question does not specify how long would sex need to last for ______ to occur. If you are trying to ask how long does it have to last for in order for it to be considered sexual intercourse, the answer is open to opinion but generally even momentary penetration will be considered sex.


Is it good to have make up sex right after every argument and will it last like that?

no and no not for long

Trending Questions
Should I have my car wrapped? Why does light have a dual wave particle model? What does the carrying of seeds to a new place? What was F. Scott Fitzgerald's daughter's name? What is the lecithin daily intake? What did suyuan woo tell an-mei when an-mei prepared for her trip to china? What cranial nerve is used for pupillary constriction? Can you use August in a sentence please? How many electrons in one columb? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the significance of the spiritual rosary in the practice of prayer and meditation? How many votes does each state have in the electorial college? What is the closest airport to Osage Beach MO? How do you remove center console from 2004 Hyundai xg350? Is the Grand National cruel? What are symptoms of chiari malformation? What is the most poinsonous land snake? How do you integrate e powerintegral2x-1? Deciduous trees are those that? What is the US Mining Law of 1812?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.