answersLogoWhite

0

How long is the 2012 Nissan Cube?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

The 2012 Nissan Cube is 13 ft. 0.7 in. (156.7 in.) long.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

How long is roadside assistance included with the 2012 Nissan Cube?

The 2012 Nissan Cube includes 3 yr./ 36000 mi. of roadside assistance.


How many valves does the 2012 Nissan Cube have?

The 2012 Nissan Cube has 16 valves.


What kind of transmission does the 2012 Nissan Cube have?

The 2012 Nissan Cube has a 6-speed manual.


What size engine does the 2012 Nissan Cube have?

The 2012 Nissan Cube has an inline 4 engine.


Is the 2012 Nissan Cube electric or gas?

The 2012 Nissan Cube is a gas-powered vehicle.


What is the turning circle of the 2012 Nissan Cube?

The 2012 Nissan Cube's turning circle is 33.4 ft..


What is the cam type of the 2012 Nissan Cube?

The 2012 Nissan Cube has double overhead cam (DOHC).


What kind of fuel does the 2012 Nissan Cube use?

The 2012 Nissan Cube runs on regular unleaded.


How tall is the 2012 Nissan Cube?

The height of the 2012 Nissan Cube is 5 ft. 5 in. (65 in.).


What is the drag coefficient of the 2012 Nissan Cube?

The 2012 Nissan Cube has a drag coefficient of 0.35 Cd.


How wide is the 2012 Nissan cube?

The 2012 Nissan cube is 5 ft. 6.7 in. (66.7 in.) wide.


What is the rear shoulder room of the 2012 Nissan Cube?

The 2012 Nissan Cube has 52.4 in. of rear shoulder room.

Trending Questions
What size wire is needed for 15 amps over a distance of 300 feet? Are how to have a mermaid baby? How to reset jaguar fail safe? Does royal gelatin jello have pig fat? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? Will headers get the starter hot so the car won't crank? How can I effectively glue rattan to wood? What does mean when he ask you ask? Where does Guano originate from? To Hrothgar was given such glory of war such honor of combat that all his kin obeyed him gladly till great grew his band of youthful comrades infers? Is there an Altaic language family? Why do ecologists ask questions about events and organisms that range in complexity from an individual to the biosphere? What kind of root and venation does bean have? If a box had to be 200 cubic inches what size would it have to be in standard inches? What is the least common multiplus of 21? Why is your 1982 Ford Bronco hard to start? How much is the frank thomas baseball card worth? Can you get introuble if someone is underage drinking at your house and you have a sign up? Is it possible for a guy who turned you down to still be jealous when he knows there is another guy in your life? What is that song on the movie igor talking about big girls?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.