0
What else can I help you with?
Related Questions
How many ear muscles does a cat have?
32 in each ear, 64 ear muscles in total.
How many bones are there in a cats ear?
A cat has 27 bones in each ear.
How many ear drums do dogs have?
Two, one in each ear, just like humans do.
An ear of corn has about 9 rows of 800 kernels each about how many kernels are in the ear of corn?
7200
How many piercings does dianna agron have?
2 in each ear
How many meaningful English words can be formed by using all the letters of the word ear using each letter once in each word?
are, ear, era
How many precings does Miley Cyrus have?
two, one on each ear
How many of stirrup bones do you have in are body?
Two, one in each ear.
How many musical does a cat have in each ear?
i dont knoe,lol
How many ears piercings do Miley Cyrus have on each ear?
20
How many mucsels do a cat have in his ear?
Cats have 32 muscles in each of their ears.
How many piercings does kesha have?
three one on her nose,and one on each ear
Trending Questions
Should juveniles being tried as adults?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The point where two air masses meet is called a?
How do you get seaman's book what are the requirements?
How did science and technology lead to the growth of Mayan influence?
What is 10 million divide by 9.856?
From where is Vanessa Hudgens mother?
How can you find garibaldi fish?
What is the time to turn a distance of 1 degree?
When was theora stephens born?
Which continent are the himalaya mountains located?
Where do you often find an adjective?
Did Hernando De Soto ever go to school?
Is Hansel and Gretel American literature?
Did Kristinia Debarge go to South Pasadena High School or was she homeschooled?
Is 3 days enough to have a opiate free urine sample?
What do the doctors say about marijuana in your system?
Is regardless a verb?
ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this?
What was The French courtly love song of the Middle Ages called?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.