answersLogoWhite

0

How many are there zong in the world?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

One zong in the world

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Who areTHE owners of zong GSM?

Zong GSM, a telecommunications company in Pakistan, is owned by China Mobile Communications Corporation (CMCC). CMCC acquired a majority stake in Zong when it entered the Pakistani market in 2008. Zong operates as a subsidiary of CMCC, which is one of the largest mobile network operators in the world.


When was Zong Zoua Her born?

See website: Zong Zoua


When was ZONG created?

ZONG was created in 2008.


Paktel takeovers by zong?

paktel takover to zong


What is the mission statement of Zong?

I believe the mission statement of zong is... "We must not lose our zong, because then we shall not use of our bong."


When did Liu Zong die?

Liu Zong died in 821.


When did Zong Ai die?

Zong Ai died in 452.


When was Zong Pu born?

Zong Pu was born in 1928.


When did Zong Yu die?

Zong Yu died in 263.


When did Zong Massacre happen?

Zong Massacre happened in 1781.


When did Xue Zong die?

Xue Zong died in 243.


When did Zong Chen die?

Zong Chen died in 1560.

Trending Questions
How many championships does Liverpool fc have? How can I create precise and clean rabbet cuts in my woodworking project? What kind of dog is Asta in The Thin Man? What did the people in the Middle Colonies wear? Where is the heated front seat module in 1999 jag xj8? What is the name of Iran's and Pakistan's border? Where can you download tera kya hoga johnny movie songs? What is 15 out of 40 as a fraction in its lowest terms? Very few cells are replaced in this organ system? How much does 275 milliliters equal in liters? Will a 60000 volt coil work with a stock 302? How do you write a sentence with the word privacy? What is the visitation in Catholicism? Why do diatoms have oil filled vaculoes? What's an easy way to get mushrooms on Pokemon Dark Rising? Why will a guy whistle when he sees a girl? What song does Lil Wayne diss Eminem in? How do you replace the front turn signal bulb located on a 1998 Mercury Grand Marquis? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? The general mood that prevailed in the 1920s was?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.