0
What else can I help you with?
Related Questions
How many babies can Hector's dolphins have at one time?
how many babies can a dolphin have ? ? how many babies can a dolphin have ? ? how many babies can a dolphin have ? ? how many babies can a dolphin have ? ?
How many babies do white tigers have at a time?
2-4 babies at a time.
How many babies does a mongoose have a one time?
a mongoose can have up to 5 babies at one time
How many babies can have a panda have at one time?
i think pandas have about 2 babies at a time! i think pandas have about 2 babies at a time!
How many babies can chipmunks get at a time?
chipmun ks can have 30 babies in a life time
Why would a Florida dolphin's belly turn pink?
The belly turns pink when the water and air temperatures are warmer.
How many babies does a mother cheetah have?
About 2-4 babies at a time.
How many babies does dusky dolphin have?
21 babies at one time ..
How many babies doe s the white tiger have at one time?
2-4 babies at a time
How many babies do narwhal have at a time?
A Narwhal can have up to 2 babies at the most.
How many babies can a elephant have at a time?
they can have upto two babies but the average is one
How many babies does a monkey have at one time?
2 at a time.
Trending Questions
Why should grizzly bears stay in zoos?
Is a person's deceased step-mother's deceased brother's living spouse any relation to them or their father at all?
How long is flight time from Las Vegas to Houston?
Who plays the boy Miley Cyrus likes in her new movie?
Where is the syllable break in the word behind?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
A word that starts with the letter i in french?
What if a auto parts stroe gives a discount to 14 of every 100 shoppers. what percent of the shoppers receive a discount?
Why 24 carat gold is not suitable for making jewelry?
When did Alessandro Momo die?
Is Janice Dickinson a lesbian?
How can you get two accounts on Horseisle with the same internet connection?
Why do some people have to pee more often than others?
Covert 5 foot 2 to meters?
What is the past tense of glad?
Can moringa seed be used to cure fibroid?
The sum of eight times a number and seven is twice the number?
What is the main difference of Bunsen burner to alcohol lamp?
What is the literacy rate of Dubai?
How did blind fury go blind?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.