0
What else can I help you with?
Related Questions
How many tablespoons equal 12 cups?
16 tablespoons equals one cup, so 12 tablespoons would equal 3/4 of a cup (6 ounces).
How many cups would 147 tablespoons equal?
There are 16 tablespoons per cup (US measurement). Therefore 147 tablespoons = 9.1875 cups.
How many cups would 30 tablespoons equal?
That is 1.875 cups
6 cups is equal to how many tablespoons?
96 tablespoons in 6 cups.
How many cups in 98 tablespoons?
98 tablespoons is equal to 6.125 cups.
3 tablespoons equal how many cups?
There are 16 tablespoons in a cup. So 3 tablespoons is equal to 3/16 cups or 0.1875 cups.
How many cups equal 895 tablespoons?
55.93 cups
How many cups is 10 tablespoons?
10 tablespoons equal 0,625 cups.
35 tablespoons equal how many cups?
There are 2.1875 cups in 35 tablespoons.
How many tablespoons of water equal 1.5 cups?
1.5 cups of water is 24 tablespoons.
How many tablespoons of water will equal 1.5 cups?
1.5 cups of water is 24 tablespoons.
How many cups of flower are in 35 tablespoons?
Regardless of substance, 35 tablespoons is equal to 2.19 cups.
Trending Questions
Are newspapers voice of public?
Where in the Bible does it say when the soul enters a newborn?
What is the definition of parallel lines?
How a hot-water radiator heats a rooms air. Include in your answer the way heat moves from the metal radiator to the room.?
What age do you have to be to watch pixels?
Is astronomy a plural noun?
What are Idahos main crops?
Which of the following molecules has the highest boiling point?
Mid-ocean ridges are formed by?
Do panthers eat foxes?
What African tribe stretched their neck with rings?
How do you rotate dispaly of your laptop?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Are the phoenix gold ryval amps any good?
What example best describes a change of medium?
If a dragster covers 1000 ft in 4 seconds traveling 300mph at 8000 rpm how many times does number 1 spark plug fire?
If water lilies cover 1000 square feet of your pond and they double every year how many square feet will they cover after 6 years?
Dividing rational numbers?
Do people soil themselves in death?
How can I create a raised platform for my bed to add extra storage space and elevate the overall look of my bedroom?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.