0
What else can I help you with?
Related Questions
What do you call the group of wovles?
Pack
Why do wovles imprint?
they eat mostly everything!!!
What eats wovles?
Well they eat meat!
What is the wolves family?
The Wovles family is the "pack" that they are in
What female animals hunt in packs?
Lions & wovles
What do wovles do?
Wolves eat deer, moose, rabbits, mice.
Is there a game for PS1 were your blocks and wovles chase you?
no that would be a boring game anyway
At the story ends with new interlopers who prevent the men from making peace Who are these second interlopers?
The Wovles
Is dogs related to wovles?
Yes. Most dogs come from them and they're both from the from a group called canidae.
How many kinds of centipedes are there?
How many kinds of centipedes are there
How many kinds of cabras?
there is how ever many kinds there is in this world
What is the collective noun for a group of wovles?
A group of wolves is a pack. Example:Hunting for food, a pack of wolves works as a team.
Trending Questions
How do you buy bikes on Pokemon pearl?
When did judaism first began to show up in Ancient history?
How do you remove passenger seat in a cobalt?
Does Saudi Arabia have freedom of speech?
Why did new France stretch so far west?
What is a butt joint and how is it commonly used in woodworking or construction projects?
What does mean brake pressure in th international truck?
How much does 8 ounces of milk weight?
What is flea power?
How old would you be if you was born in 1959?
Location freeze plug 1999 dodge ram 318?
Is chip esten on disney channel's upcoming show jessie?
Why did the framers of the US Constitution grant members of Congress the freedom from arrest while Congress is in session except for serious crimes?
W h davies the poem the fog?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
How much did Lil Wayne album rebirth sell?
Explain the role of NGOs in promoting Tribal Development?
How did Riverside CA get its name?
How would you write womens in plural form?
What do dead-ball sitution mean?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.