answersLogoWhite

0

How many ounces are in 70 liters?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/17/2019

Answer: 70 L = 2,366.981 fl oz(US)

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

How many liters in 70 ounces?

70 liters = 2,366.98 US fluid ounces.


How many liters are in 70 liquid oz?

16 fluid ounces make 1 pint = 1/8 gallon = 0.475 liter. 70 fluid ounces = 2.08 liters


How many ounces are in 2.8 Liters?

94.7 ounces are in 2.8 liters.


How many liters is 38 ounces?

38 ounces=1.12379412 liters


How many ounces liters?

Eight fluid ounces is 0.236588 liters.


How many liters equals 384 ounces?

384 fluid ounces = about 11.4 liters.


How many liters is 78 ounces?

78 liters = 2,637.49 fluid ounces.


How many liters are in 12 ounces?

There are approximately 0.354882 liters in 12 ounces.


How many ounces in 22 liters?

There are approximately 741.31 ounces in 22 liters.


How many liters in 213.3 oz of water?

1.64 gal 1 gallon makes 128 ounces and 1 ounce is 0.0078 gallon in U.S measure. There are 8 ounces in a cup, 2 cups in a pint, 2 pints in a quart and 4 quarts in a gallon. That makes 128 ounces in a gallon US. In UK 20 ounces to the pint, 8 pints to the gallon which makes 160 ounces Imperial measure.


8 ounces is equal to how many liters?

Eight fluid ounces = about 0.2366 liters.


How many ounces are there in 1.50 liters?

There are approximately 50.7 fluid ounces in 1.50 liters.

Trending Questions
What kind of containers are used to hold palmas at temperatures of millions of degrees? What are the dimensions of a flatbed rail car? When president Rutherford B. Hayes attacked the practice of patronage his supporters were called? What did the united states join the allies and help to win world war 2? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? What is perpendicular to the line 3x plus y equals 2? Why is counseling important and what is done in that area? What is a line on which numbers are assigned to points callled? Can 35mm film go through TSA security screening? How do you covert 19 divided by 7 into a mixed number? How do you say calf in french? Does antone have Answers to study link 2.2 number hunt? Where is the windshield washer pump on a 1996 Dodge Ram 1500 Truck and how do you replace it? What was the first cereal used by man? What is the atomic number based on in the nucleus? Can Muslim's eat venison? What is the future of safety matches? Why would a heater turn on and off on its own? What is the name of the woody stem of a raspberry shrub? What is 781679 rounded to the nearest hundred?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.