answersLogoWhite

0

How many pages does Sweeney Astray have?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Sweeney Astray has 85 pages.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What is the ISBN of Sweeney Astray?

The ISBN of Sweeney Astray is 0946755035.


When was Sweeney Astray created?

Sweeney Astray was created on 1983-11-01.


How many of stars of heaven di Satan lead astray?

Staars are not beings so they cannot be led astray


Can you give an example of astray in a sentence?

Defined: going in a wrong direction or get out of control Sentences: I was led astray in Washington, D.C when given wrong directions. Many people who rely on GPS devices are led astray.


What part of speech is astray?

Astray is an adverb.


How many people did the real Sweeney Todd kill?

It hasn't been proven that there ever was a real 'Sweeney Todd', but it is said that Sweeney killed about 168 unsuspecting customers.


What has the author Brian Sweeney written?

Brian Sweeney has written: 'Sweeney on Sweeney'


When was Astray created?

Astray was created on 2000-08-29.


What is the definition of astray?

astray means to wonder off the right path


When was A Soul Astray created?

A Soul Astray was created on 1914-05-11.


When was Black Sheep Astray created?

Black Sheep Astray was created in 1973.


When was Christendom Astray from the Bible created?

Christendom Astray from the Bible was created in 1884.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.