0
What else can I help you with?
Related Questions
Which bird has the longest neck?
A giraffe only has 7 neck bones and a swan has 22 to 25.
How many kilometers in 47 pounds?
Kilometers are distances, pounds are weights - they do not mix
A puppy weights 4 pounds when there born and they weight 75 when there bigger how many weights does it gain?
4 pounds from 75 pounds is 71 pounds, so the dog has gained 71 pounds in weight.
How many weights is Jennifer Lopez?
145 pounds
How many pounds does a female giraffe eat of food each day?
A female giraffe eats up to 140 pounds of food a day. Aniela Chipia (3rd grader)
How many pounds does the biggest Redwood tree in California weigh?
It weights 69million pounds.
How many possible weights are there between 10 and 20 pounds?
There are 11 possible weights between 10 and 20 pounds (excluding 10 and 20). These weights are 11, 12, 13, 14, 15, 16, 17, 18, and 19 pounds.
How many pounds do you think the average giraffe ways?
350 three hundred and fifty
If a baby weights 1300 grams how many pounds is this?
About 2.87 pounds.
What is the weight of the giraffe?
About 2100 pounds.
If a watermelon weights 10 pounds how many ounces does it weight?
There are 16 ounces in a pound so if the watermelon is 10 pounds that would be 160 ounces.
How many pound in a laptop?
a laptop usually weights 6 to 7 pounds.
Trending Questions
Why can't regular pentagons tesselate?
What is the scientific name for sensitive skin?
What are synonyms for forefront?
When was Luke called by Jesus?
What are some common communication challenges faced by individuals with hyperverbal autism?
What is ASDA's equal opportunities policies?
Which is farther south Brownsville in the US or the city of chihuahua?
When did Abraham Lincoln went to see the Antietam battlefield?
What do you call a frozen pickle?
Pokemon Platinum game id code?
Is Jamaica in Brazil?
Does cooper die in One Tree Hill?
What kind of damage did hurrricane earl do?
What is a peripheral graphic array?
How many Buddy Holly records have been sold?
Who is lulia in to kill a mockingbird?
Do 8 and 16 hour security guard training certificates in NYC lose merit after time or anything else?
What has the author June Vendall Clark written?
What weapons does the 82nd airborne division use?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.