0
What else can I help you with?
Related Questions
How many syllabe does the word viviparous have?
4
How many syllabe does rake have?
It has one syllable.
How many syllabe in word glade?
It has one syllable.
How many syllabe ls in the word foot?
There is one syllable.
Which is the only state with on syllabe?
Maine.
What is the syllabe of the word attended?
at-ten-ded
What does the syllabe im mean?
I'm stands for ' I am '.
Which syllabe in abscess is accented?
The first syllable.
What is a 5 syllabe sentence?
i like to eat banana
Witch syllabe is stressed in the world profit?
The first syllable.
Is destroy first syllabe stressed?
The second syllable is stressed.
Is aloud a one syllabe homophone?
"Aloud" is two syllables.
Trending Questions
Did Nixon win his election by a landslide?
One who is appreciative of art and beauty?
What is 2 to the power of 63?
Where is the freeze plug on a 1996 Chrysler Sebring Coupe 2.5?
Should you increase taxes or cut taxes?
What is meaning of powerless speech mannerisms?
What is 20-20kHZ frequency range in feet?
How do you take care of pearls?
What does straved mean?
What is mailroom services?
What is another term for a new religion?
What can you mix with tarantula tequila?
Why did William Wilberforce write the song amazing grace?
What is the gravitational condensation theory?
Is UNIX a hardware or software?
Who is Bella Thorne's mom?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is Superman's real name?
If a person can't see is blind a person who can't hear is deaf what do you call a person who can't taste?
Why is cornstarch and water an emulsion?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.