0
What else can I help you with?
Related Questions
What is another word for frankfurter with the word cat or dog in it?
"Hot Dog " . A frankfurter us used to make a "hot dog", however a hot dog is not a frankfurter.
What do you call a dog that sweats so much?
A hot dog.
How much did a hot dog cost in today?
They run anywhere from $2.00 to $5.00 from a hot dog stand.
When was the hot dog intoduced in the US?
It has been rumored that sometime in the 1860's the hot dog was introduced by German immigrants.
What two words make up hot dog?
In the US, the term "hot dog" refers to both the sausage by itself and the combination of sausage and bun.
How much potassium is in a hot dog?
3
What has more cholesterol and fat a hot dog a sausage link?
A hot dog doesn't have too much cholesterol
How much for a coke and hot dog at the super bowl?
$35 for a coke and a dog.
How much is a hot dog if you can get 2 and a soda for 3.00 or 2 hot dogs and 2 sodas for 4.50?
Soda-$1.5 Hot Dog-$.75
How much is a hot dog in the UK?
About one pound
How much was a hot dog at a baseball game in the 1920's?
a hot dog cost a nickel in those days
What is the famous food fo US?
The burger of course! Or the hot dog...
Trending Questions
Is there a recall on 2006 PT cruiser?
Where do you go to get a permit to put up a fence in LA?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp?
Which Ohio State Football player is called Animal?
Worsted system and woolen system?
What is another name for a tire's height?
How many days old are you today if you were born March 8 1949?
Is ohm's law applicable to ac or dc and why?
Son and daughter of Ferdinand Magellan?
How big is Selena gomez's mole?
What is the value of a 2003 US dollar coin?
Animals in trenches?
Does Minnesota have tolls on its roads?
What is 147 square feet converted to square meters?
Is this statement true premiums for term life insurance decrease as people get older?
What should I do if my toilet has a weak flush?
When was Mann Kee Awaaz Pratigya created?
What is the recipricol of 7654321?
What is the unit price of a product?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.