0
What else can I help you with?
Related Questions
How old was kesha when she sang her first song?
When Kesha was 24, she sung her first song.
Who sang the song old red first?
George Jones
How old was pixie Lott when she first sang a song?
7
Who old was Katy perry when she sang her first song?
2007
How old was bob Marley when he sang his first song on stage?
5
How old was Joe Jonas when he sang his first song?
The Jonas brothers were about 10 or 11.
How old was the lion king when he made his first song?
Simba was one day old when he sang The Morning Report
How old was declan galbraith when he sang tears in heaven?
Declan was 14 years old when that song was recorded.
How old was Madonna when she did 4 minutes?
In 2008 (March) that would make her like 48 when the song came out?
How old was just bieber when he first sang where are you now?
he sang it as a cover, its not his own song. But he covered it at the age of 12-13.. it was before one time anyway. :)
Who sang the old song At Last?
Etta Jones
How old was Cody Simpson when he sang his FIRST song?
He started to play the guitar at 6 years old & started singing at 12. Hope I helped. :]
Trending Questions
List three biological activities that require energy?
What type of candy starts with a d?
What is meaning of tian shi?
International rating of habib metropolitan bank?
How long does it take to decompose a foam cup?
What can a protagonist approach to conflict show about the cultural values behind a work of literature?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
Where was the best place to build motte and bailey castles?
Is Pokemon Rumble for wiiware software or is it on a disk?
How fast can the ferrari 612 GTO go?
What 2 sides fought in world war 1?
What word is formed by unscrambling the letters iamgseo?
How do you change the wheel bearings in a Oldsmobile Alero?
When did Graham Martin die?
Where is shark valley and what species of sharks live there?
Does Uranus have snow?
What NFL teams did Randell Cunningham play for?
What is the significance of the upside down quarter note in music notation?
How do I measure correctly to order window treatments?
How do you fix a twisted ankle?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.