answersLogoWhite

0

How old is Enzo Biagi?

User Avatar

APIBirthday ∙

Lvl 1
∙ 11y ago
Updated: 8/19/2019

Enzo Biagi was born on August 9, 1920 and died on November 6, 2007. Enzo Biagi would have been 87 years old at the time of death or 94 years old today.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

How old was Enzo Biagi at death?

Enzo Biagi died on November 6, 2007 at the age of 87.


What is Enzo Biagi's birthday?

Enzo Biagi was born on August 9, 1920.


When was Enzo Biagi born?

Enzo Biagi was born on August 9, 1920.


When did Enzo Biagi die?

Enzo Biagi died on November 6, 2007 at the age of 87.


What is the birth name of Peter Biagi?

Peter Biagi's birth name is Peter Alexander Biagi.


How old is Enzo Pérez?

As of June 2014, Enzo Pérez is 28 years old.


How old is Enzo Pineda?

Enzo Pineda is 21 years old (birthdate: August 12, 1990).


How old is Enzo Scifo?

Enzo Scifo is 45 years old (birthdate: February 19, 1966).


How old is Enzo Maresca?

Enzo Maresca is 31 years old (birthdate: February 10, 1980).


How old is Enzo Francescoli?

Enzo Francescoli is 49 years old (birthdate: November 12, 1961).


How old is Enzo Emanuele?

Enzo Emanuele is 40 years old (birthdate: June 10, 1977).


When was Carlo Biagi born?

Carlo Biagi was born in 1914.

Trending Questions
Does radiotherapy make you hot? What is the mRNA strand for ggctatatcctgcgctatacgcta? What iv giving set do you use with albumin? What is the smallest fraction for 21 15th's? How many loops in a mammals circulatory system? How did Hundred Years War contribute to the reformation? How did travel affect the feudal system? Is Adam sandler of Happy Gilmore the same as the producer of the price is right? Will a floating floor have bounce? What does hairdressers mean in french? Who are five famous Jews? Where is the second clue to get the box? How much does the taxpayer pay for the care of the president's pets? If you are a 5' 8 145 pound 15-year-old how many calories per day should you eat to lose 20 pounds? Are horse drawn vehicles allowed on public roadways? How many quarts of transmission oil in 1983 280zx? What caused the collapse of the tang dynasty? Energy resources that can't be replaced soon? How do you know if you have an illness with your chest? How many Acres in a circle 2.5 mile radius?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.