0
What else can I help you with?
Related Questions
Who is George Sampson's mother?
George Sampson's mother is 39 year old divorced Lesley Sampson.
How old is geogre Sampson?
George Sampson is 16 this month.
How Old Is George Sampson and When is his Birthday?
George Sampson is 16 at the moment and his birthday is the 29th June
How old is George Sampson's brother?
15
George t Sampson how old he is today?
16
How Old Was George Sampson When He Won Bgt?
George was 14 almost 15
Is Zoe George Sampson's sister?
Zoe George Sampson is a brother and sister. George Sampson is the brother and Zoe Sampson is his sister.
Is George Sampson dead?
No George Sampson Is Not Dead.
How old was George Sampson when he won Britain's Got Talent?
He was 14 years old.
Would george Sampson go out with a 12 year old?
Noee.
How old do you have to be to go out with george Sampson?
im guessing youd have to be about 12.
What is George Sampson Nationallty?
George Sampson is British, he lives in Manchester. He was last years winner of Britain's got Talent, and is absolutely adorable for a 15 year-old!!!
Trending Questions
Where is the Ferrari car manufactured?
Why are my lifters tapping after flood water was drained from the engine and the oil has been changed?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Did Alexander Fleming do bad?
What is the meaning of game over?
What is 390.98 rounded to the nearest square meter?
What are intercalated disks?
Why do you think graphs are a useful way to display information?
Who is lyasan utyasheva?
What objects in outer space can hit earth and cause major damage to earth?
Why do Tamils wear dhotis?
How much is yu gi oh card number 39 utopia worth?
How much should you feed your 30 lb dog?
How much does an aircooled vw engine weigh?
What are organisation management and technology dimensions of information systems?
How many miles from Houston TX to Franklin TN?
What is the correct spelling for Best friend?
What is weight of pressure treated 12 x 12 piling?
Why are my tomato plant leaves drooping and curling?
What is the process that produces starch from the leaves?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.