0

How old is Giuseppe Patanè?

Anonymous

∙ 15y ago

Updated: 8/18/2019

Giuseppe Patanè was born on January 1, 1932 and died on May 29, 1989. This would have been 57 years old at the time of death or 78 years old today.

Wiki User

∙ 15y ago

What else can I help you with?

Related Questions

When was Patan district created?

Patan district was created in 2000.

When did Battle of Patan happen?

Battle of Patan happened on 1790-06-20.

How do you reach Patan from Ahmedabad by train?

You can Catch 9911 Ahmedabad Patan Intercity Express Leaving from Ahmedabad @ 18:25 Hours From Platform No. 7 Which Reach Patan @ 1955 Hours

What has the author Jerzy Patan written?

Jerzy Patan has written: 'Historia Koobrzegu W Fotografii: Kolberg'

How old is Giuseppe Guerini?

Giuseppe Guerini is 41 years old (birthdate: February 14, 1970).

How old is Giuseppe Rossi?

Giuseppe Rossi is 24 years old (birthdate: February 1, 1987).

How old is Giuseppe Betori?

Giuseppe Betori is 64 years old (birthdate: February 25, 1947).

How old is Giuseppe Saronni?

Giuseppe Saronni is 53 years old (birthdate: September 22, 1957).

How old is Giuseppe Bergomi?

Giuseppe Bergomi is 47 years old (birthdate: December 22, 1963).

How old is Giuseppe Favalli?

Giuseppe Favalli is 39 years old (birthdate: January 8, 1972).

How old is Giuseppe Rotunno?

Giuseppe Rotunno is 88 years old (birthdate: March 19, 1923).

How old is Giuseppe Sculli?

Giuseppe Sculli is 30 years old (birthdate: March 23, 1981).

Trending Questions

What is the term for component if a solution in which another substance dissolved? Is polyvinyl chloride PVC hygroscopic? What is some cheap things to do to a 1994 350 5.7l tbi engine to add horsepower? What did Klaatu say? How many giant pandas are there? What were the quarters scores of super bowl XXX1? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? What kind of pit bull is the target pit bull? Did the sabertooth tiger have predators? Does global warming have anything to do with the carbon dioxide level in the air? What is the maximum Distance for a taser gun to work? How did longhorn caverns form? How many hours does it take to drive from Tampa FL to Athens GA? At what age is it ok for a child to walk home from school by themselves? What does a 10 second car mean? What are examples of achene fruits? What do you do if you are the girl a boy is cheating on his girlfriend with? Does 10C TO F 50F? Who has the number one book in gravity falls? What origin does verbatim come from?

Resources

Top Categories

Product

Company

Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.