0
What else can I help you with?
Related Questions
What is Hollie Smith's birthday?
Hollie Smith was born on November 17, 1982.
When was Hollie Smith born?
Hollie Smith was born on November 17, 1982.
Where is hollie from American Idol from?
Hollie Cavanagh is 18 years old and from McKinney, TX
How old is hollie steel in 2011?
Hollie turned 13 on July 1, 2011.
How old is Hollie-Jay Bowes?
Hollie-Jay Bowes is 22 years old (birthdate: January 17, 1989).
Does Aidan Davis fancey hollie steel?
I doubt it as Hollie is only ten years old
How old is hollie rae watts?
148
How old is hollie king-burrows?
she is 12
How old is hollie king -burrows?
she is 12
Did hollie get eliminated in American Idol?
Yes Hollie Cavanagh 18 years old | McKinney, TX was voted off May 10 2012
How do say Hollie in french?
Hollie
What nicknames does Hollie Steel go by?
Hollie Steel goes by Hollie bee Steel.
Trending Questions
Should juveniles being tried as adults?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The point where two air masses meet is called a?
How do you get seaman's book what are the requirements?
How did science and technology lead to the growth of Mayan influence?
What is 10 million divide by 9.856?
From where is Vanessa Hudgens mother?
How can you find garibaldi fish?
What is the time to turn a distance of 1 degree?
When was theora stephens born?
Which continent are the himalaya mountains located?
Where do you often find an adjective?
Did Hernando De Soto ever go to school?
Is Hansel and Gretel American literature?
Did Kristinia Debarge go to South Pasadena High School or was she homeschooled?
Is 3 days enough to have a opiate free urine sample?
What do the doctors say about marijuana in your system?
Is regardless a verb?
ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this?
What was The French courtly love song of the Middle Ages called?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.