answersLogoWhite

0

How old is Margaret fergus?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/19/2019

12 years old

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

How old is Fergus Martin?

Fergus Martin is 56 years old (birthdate: January 18, 1955).


How old is Fergus Riordan?

Scot-Irish actor Fergus Riordan is 19 years old (born July 22, 1997).


How old is Fergus McMaster?

Fergus McMaster was born on May 3, 1879 and died on August 8, 1950. Fergus McMaster would have been 71 years old at the time of death or 136 years old today.


How old was Fergus McMaster at death?

Fergus McMaster died on August 8, 1950 at the age of 71.


What has the author Norman Fergus Black written?

Norman Fergus Black has written: 'A geographical work book' 'History of Saskatchewan and the Old North West' -- subject(s): History


When was Fergus Suter born?

Fergus Suter was born in 1858.


How old is Margaret Peyton?

Margaret Peyton is dead.


A showname for a horse called Fergus?

Sir Ferguson Fleeting Fergus Mr Fergy Fine Fergus


What is the birth name of Fergus Grady?

Fergus Grady's birth name is Fergus Stewart Murray Grady.


Where is the Fergus Falls Public Library in Fergus Falls located?

The address of the Fergus Falls Public Library is: 205 East Hampden, Fergus Falls, 56537 2930


How old is Margaret Okayo?

Margaret Okayo is 35 years old (birthdate: May 30, 1976).


How old is Margaret O'Brien?

Margaret O'Brien is 80 years old (birthdate: January 15, 1937).

Trending Questions
How can I spend more time with horses if I dont have my own? What is b squared to 100? Who settled the colony of caralina? What answer did shadrack make to the unasked question? What is the names of all jls members? Sharp atomic clock SPC373 can not get your outside temp to set? What is the origin of wig? What steps did Lincoln take to preserve the union before and after the fighting at fort Sumter? What are the best techniques for applying whitewash paint to brick surfaces? 96 mercury mystique fuse configuration? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do crafts help in school? What do the bells do in the plaza in Kirby's epic yarn? What did the Byzantine empire do to control the Roman Empire? Can a pastor have someone committed? What are some famous people that begin with the letter z? What is controllable and uncontrollable cost? Where can you have an outdoor outing in Rhode Island? Where is the Oxygen sensor on a 1997 4runner? What movies has Anna popplewell starred in?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.