answersLogoWhite

0

How old is Paul Magee?

User Avatar

APIBirthday ∙

Lvl 1
∙ 15y ago
Updated: 8/18/2019

Paul Magee is 63 years old (birthdate: January 30, 1948).

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

What is Paul Magee's birthday?

Paul Magee was born on January 30, 1948.


When was Paul Magee born?

Paul Magee was born on January 30, 1948.


How old is Brandon Magee?

As of the end of the 2013-2014 NFL season Brandon Magee is 23 years old.


How old is Jeffery Maggee in the novel Maniac Magge?

Jeffery Magee is 12 years old in the novel "Maniac Magee."


How old is manic magee?

he is 11 years old


How old is Rusty Magee?

Rusty Magee was born on August 6, 1955 and died on February 16, 2003. Rusty Magee would have been 47 years old at the time of death or 59 years old today.


How old is Amanda beale from manic magee?

Amanda Beale is 11 years old in the book "Maniac Magee" by Jerry Spinelli.


Who directed Paul Jones and Patrick Magee in Demons of the Mind?

Peter Sykes


How old are Russell and piper in Maniac Magee?

Russell and Piper are both 11 years old in the book "Maniac Magee" by Jerry Spinelli.


How old was Rusty Magee at death?

Rusty Magee died on February 16, 2003 at the age of 47.


How old is maniac in maniac magee?

He Is 11


How old is John Gillespie Magee Jr.?

John Gillespie Magee Jr. was born on June 9, 1922 and died on December 11, 1941. John Gillespie Magee Jr. would have been 19 years old at the time of death or 93 years old today.

Trending Questions
How do you replace the EGR on a Chevy Tracker? How do you install intagram? What was the name of James Watt's father? Which of the foefollowing not considered an antigen-presenting cell? Who was the first deputy marshall on Gunsmoke? Egg's functions and its neutrients? Describe the search for peace in the 1920s and its results? What is the measure of an exterior angle of a 25 sided polygon? Is 3km longer than 2900m? Who is on of the Texas state's us Senators now? What is hackensack? What is the circumference of a circle with a diameter of 5m in terms of pi? Who developed the Hangul writing system? What is systalic and diastalic? Is one half large than one frouth? What is 9 divied by 3593? How much money is 14k gold worth? What is a common obstacle that keep soldiers from receiving mental health assistance? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? What is the definition of low sugar?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.