answersLogoWhite

0

How old is Sosuke Sumitani?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/18/2019

Sosuke Sumitani is 31 years old (birthdate: January 14, 1980).

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

What is Sosuke Sumitani's birthday?

Sosuke Sumitani was born on January 14, 1980.


When was Sosuke Sumitani born?

Sosuke Sumitani was born on January 14, 1980.


How old is Masaki Sumitani?

Masaki Sumitani is 42 years old (birthdate: December 18, 1975).


How tall is Anna Sumitani?

Anna Sumitani is 164 cm.


What is Masaki Sumitani's birthday?

Masaki Sumitani was born on December 18, 1975.


When was Masaki Sumitani born?

Masaki Sumitani was born on December 18, 1975.


When was Ginjiro Sumitani born?

Ginjiro Sumitani was born on 1987-07-19.


What was the name of the boy in the movie ponyo?

The five year old's name is Sosuke .


When was Sosuke Ikematsu born?

Sosuke Ikematsu was born on 1990-07-09.


When was Sosuke Toda born?

Sosuke Toda was born on 1941-01-11.


What is his first name Aizen or Sosuke?

i don't really know but i guess i have to choose won so "Aizsuke." First- Sosuke Last- Aizen so if you were writing his name in America his name would be written Sosuke Aizen.


Is sosuke sagara gay?

Sosuke Sagara is a fictional character from the anime series Full Metal Panic!. His sexual orientation is not explicitly stated in the original series.

Trending Questions
What is the molality of a solution made by dissolving 2 moles of NaOH in 6kg of water? Why does joy make suds? Why manuel v pangilinan still single? What is the cost of becoming a teacher? What is the plural form for words ending in ey? What shape has exactly 2 perpendicular sides? Who passes unemployment extensions? What tragedy happened in space exploration in 1986? How do i compare Britain and the 13 colonies in the mid-1700s? Why did slavery end answers for kids? What is the value of an HS .22 cal hand gun? What is the mRNA strand for ggctatatcctgcgctatacgcta? Who is the Cheerleader in nada surf's popular video? How do I lose 2lbs a day on a 1200 calorie diet I'm a 20 year old female weight 258 also how much protein and carbs should I have everyday? Why does George have a toothbrush sticking out of his ear in harry Potter? What are some good ideas for tonight at home? What do you call a fear of curtains? In what song is the line Even Rock Hudson lost his heart to Doris Day? What is the name of polygon with 1000 sides? How long does radiation stay in the body after treatment?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.