answersLogoWhite

0

How old was Glenn Miller at death?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/19/2019

Glenn Miller died on December 15, 1944 at the age of 40.

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

How old is Glenn Miller?

Glenn Miller was born on March 1, 1904 and died on December 15, 1944. Glenn Miller would have been 40 years old at the time of death or 111 years old today.


How old are Glenn Miller's son and daughter?

Glenn Miller's son, Steven, was born in 1946, making him 77 years old as of 2023. His daughter, Anne, was born in 1941, which makes her 82 years old in 2023.


When was Glenn Miller born?

Glenn Miller was born on March 1, 1904.


When was The Glenn Miller Story created?

The Glenn Miller Story was created in 1954.


When was Glenn Miller Orchestra created?

Glenn Miller Orchestra was created in 1937.


What year did glenn miller record adios?

when Did Glenn Miller Recored Adios


What is Glenn Miller's birthday?

Glenn Miller was born on March 1, 1904.


When is Glenn Miller's birthday?

Glenn Miller was born on March 1, 1904


What is the duration of The Glenn Miller Story?

The duration of The Glenn Miller Story is 1.92 hours.


Did people like glenn miller music?

Yes. Glenn Miller was extremely popular.


Is Glenn Miller married?

Yes, Glenn Miller married to Helen Burger in 1928


Is Glenn Miller tall?

Andrew Glenn Miller is 6' 1 1/2".

Trending Questions
Who put the qoute in the Declaration of Independence 'These united colonies are and of right ought to be free and independent states'? What does the sun turn into helium? What is domain sampling in statistics? How do you make 29 out of 1 2 3 and 4? Is burek Turkish? What was Sacagawea's family life like? Which countries have the least tornadoes? What words can be formed by the word Butter? Is methadone best taken once a day or split into twice a day? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What is the significance of the song measure in music composition and how does it contribute to the overall structure of a musical piece? What is a simple definition of allusion? Can a 13 year old get a job? What does the medical abbreviation GOT mean? What were the terms of the Non-Intercourse Act? Is he on any money? What is the value of a 125 louisville slugger powerized bat says genuine u1 kent hrbek it was one of his practice bats at the metrodome inside the top of bat it has number 14 in the tip of the bat? What are some examples of chemical weatering? What are the different types of screw nuts and how are they used in various applications? When does Toy Story 3 come out in stores?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.