answersLogoWhite

0

How old was Lars-Eric Lindblad at death?

User Avatar

APIBirthday ∙

Lvl 1
∙ 14y ago
Updated: 8/19/2019

Lars-Eric Lindblad died on July 8, 1994 at the age of 67.

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

How old was Jan Lindblad at death?

Jan Lindblad died on April 5, 1987 at the age of 54.


How old is Jan Lindblad?

Jan Lindblad was born on July 19, 1932 and died on April 5, 1987. Jan Lindblad would have been 54 years old at the time of death or 83 years old today.


How old is Lars-Eric Lindblad?

Lars-Eric Lindblad was born on January 23, 1927 and died on July 8, 1994. Lars-Eric Lindblad would have been 67 years old at the time of death or 88 years old today.


How old is Göran Lindblad?

Göran Lindblad is 61 years old (birthdate: January 12, 1950).


How old is Matt Lindblad?

NHL player Matt Lindblad was born on 03-23-90 and as of the end of the 2013-2014 season is 24 years old.


What is the birth name of Jarl Lindblad?

Jarl Lindblad's birth name is Jarl Martin Lindblad.


What is Lindblad terms?

I think Lindblad is an equation.


When was Rune Lindblad born?

Rune Lindblad was born in 1923.


When did Rune Lindblad die?

Rune Lindblad died in 1991.


When was Lars Lindblad born?

Lars Lindblad was born in 1971.


What is Göran Lindblad's birthday?

Göran Lindblad was born on January 12, 1950.


When was Göran Lindblad born?

Göran Lindblad was born on January 12, 1950.

Trending Questions
What is an example of paradoxes? What part of an element determines its ability to combine with other elements? How do you Manage copper levels in a hot tub? Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person? What kinds of credit cards allow one to apply online? What should I do if my dog is tired and has a dry nose? 2 cups is equal to how many ml's? 50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution? Who was Athena' rival in the city-state? What is a recipe from colonial Rhode Island? Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK? What is P0153 codes on Toyota Sienna 3.0 engine? Which concept did the Maya understand before europeans? What is 12times 8? Does Jon Gruden still get paid from the buccaneers? How can I find a replacement head for my Kobalt weed eater? Why is my kitten growling while playing? How do you define global environmental scan.? What is the complementary sequence for atgcccgggtgtcgtagttga? What happened to st therese of lisieux when she was 4?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.