answersLogoWhite

0

How tall is Burke Bryant?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Burke Bryant is 5' 10".

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

How tall is Burke Pushman?

Burke Pushman is 6'.


How tall is Burke Ewing?

Burke Ewing is 6'.


How tall is Dominic Burke?

Dominic Burke is 6'.


How tall is Glenn Burke?

Glenn Burke is 6'.


How tall is Albridge Bryant?

Albridge Bryant is 6'.


How tall is Burke McCrory?

Burke McCrory is 5' 10".


How tall is Burke McLain?

Burke McLain is 5' 11".


How tall is Burke Deaton?

Burke Deaton is 6' 9".


How tall is Burke Morgan?

Burke Morgan is 6' 3".


How tall is Bartley Burke?

Bartley Burke is 5' 10".


How tall is Christie Burke?

Christie Burke is 5' 7".


How tall is Clem Burke?

Clem Burke is 5' 11".

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.