0
What else can I help you with?
Related Questions
When was Dicu Aurel born?
Dicu Aurel was born on May 30, 1971, in Bucharest, Romania.
How tall is Aurel Bantzer?
Aurel Bantzer is 184 cm.
How tall is Aurel Manthei?
Aurel Manthei is 175 cm.
What movie and television projects has Dicu Aurel been in?
Dicu Aurel has: Played Throne in "The Prophecy: Uprising" in 2005. Played Throne in "The Prophecy: Forsaken" in 2005. Played Vampire Male in "BloodRayne" in 2005. Played Monky man in "Mammoth" in 2006. Played Tiny Wallace in "Pumpkinhead: Ashes to Ashes" in 2006. Played German officer with scar in "Barbarossa" in 2009. Played Ianache Elefterios (2009-2010) in "Aniela" in 2009.
When was Aurel Guga born?
Aurel Guga was born on 1898-08-10.
When was Aurel Babeş born?
Aurel Babeş was born in 1886.
When did Aurel Wintner die?
Aurel Wintner died in 1958.
When was Aurel Wintner born?
Aurel Wintner was born in 1903.
When was Aurel Macarencu born?
Aurel Macarencu was born in 1963.
When was Aurel Persu born?
Aurel Persu was born in 1890.
When did Aurel Persu die?
Aurel Persu died in 1977.
When did Aurel Ciupe die?
Aurel Ciupe died in 1985.
Trending Questions
Ano ang klaseng pagkain ang bawal na pagkain sa pusa?
How common are Ehlers Danlos syndromes?
What was the name of the first motor car?
Are there bugs on my skin?
What does devoted to a religion mean?
What is writing a fraction as an equivalent fraction with a larger denominator called?
What is 70 percent of 630?
Are Mario and Chris rock brothers?
Why are there no nerve endings in articular cartilage?
What age is Jo brand?
How much does a 2004 ferrari enzo cost?
How can you mine in Minecraft Pocket Editon?
Are you mad or nah?
Why did john Adams asserted that Jefferson plagiarized the declaration of independence from the works of which philosopher?
When does dratini evolve into a dragonair in Pokemon leaf green?
What is a quarter to seven?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What is the Royal Danish Ballet's Website?
What is the length of a triangle that has a 40 inch hypotnuse and a 90 degree angle?
What is the correct spelling of the singular possessive form of falcons?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.