0
What else can I help you with?
Related Questions
What is the birth name of Gus Van Sant?
Gus Van Sant's birth name is Gus Greene Van Sant Junior.
What is Gus Van Sant's birthday?
Gus Van Sant was born on July 24, 1952.
When was Gus Van Sant born?
Gus Van Sant was born on July 24, 1952.
How old is Gus Van Sant?
Gus Van Sant is 59 years old (birthdate: July 24, 1952).
Does Gus Van Sant support same-sex marriage?
Yes, director Gus Van Sant spoke out against Proposition 8 in California.
Who is the director of good will hunting?
Gus Van Sant
Who was the director of Good Will Hunting?
Gus Van Sant
Who directed the movie 'Milk'?
Gus Van Sant.
Finding Forrester who made the movie?
Gus Van Sant.
What is Gus Van Sant famous for?
Gus Van Sant is famous for being a film director. He has directed good Will Hunting, Milk, My Own Private Idaho, Even Cowgirls Get the Blues and Finding Forrester.
What is the name of the pink Gus's?
Pink gus's name is Gus Van Sant. This is his first novel and one of the most successful one.
Hitchcock film made by Gus Van Sant 1998?
Remake of Psycho.
Trending Questions
Does Zipporah And Moses Ever Have A Child?
How does the size of the moon compare to the size of the Earth?
What is a gas furnace and its advantage?
Where is the thermostat located on a 1992 Cadillac Seville?
Is this a tear and tears homophone or homograph?
What year was Henry viii became king of England?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What county is shannon airport in?
Where are plastic bottles assembled?
How many years does a felony show up on a background check in AZ?
Are rhinoes cold blooded or warm blooded?
What was the name of the 282 laws that were established by king Hammurabi?
What do the markings on the side of a B-52 mean?
How can you locate your towed car?
When did Alexander MacDonald Shook die?
Why did the colonial times need surveyors?
Does beef jerky have worms?
Is a wolf spider bite dangerous and what are the potential risks associated with it?
Is dbz infinite world on xbox 360?
Are plastic bags toxic?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.