0
What else can I help you with?
Related Questions
How tall is Ljubomir Todorovic?
Ljubomir Todorovic is 173 cm.
How tall is Ljubomir Jurkovic?
Ljubomir Jurkovic is 196 cm.
When was Nicholas C. Petris born?
Nicholas C. Petris was born in 1923.
When was Leandro De Petris born?
Leandro De Petris was born on 1988-01-24.
What is 'petris' in English?
By the rocks or To the rocks is the English equivalent of 'petris'. The Latin noun is in the ablative or the dative case. As an ablative, it translates as 'by the rocks'. As a dative, it translates as 'to the rocks'.
What has the author Chris Petris written?
Chris Petris has written: 'How to restore your Corvette 1963/1967' -- subject(s): Corvette automobile, Conservation and restoration, Handbooks, manuals
When was Ljubomir Simović born?
Ljubomir Simović was born in 1935.
When was Ljubomir Tadić born?
Ljubomir Tadić was born in 1925.
When was Ljubomir Popović born?
Ljubomir Popović was born in 1934.
When did Ljubomir Maraković die?
Ljubomir Maraković died in 1959.
When was Ljubomir Maraković born?
Ljubomir Maraković was born in 1887.
When did Ljubomir Ognjanović die?
Ljubomir Ognjanović died in 2008.
Trending Questions
What is the term used to describe the ratio of force and the area on which it acts?
Who was married to Joan Plowright?
How much is a heat lamp?
What pushes food through the small intestine?
Is a tsunami a single wave?
When did Congo Bongo happen?
What is the of human population?
If the torque converter goes bad on a 4x4 Chevy Blazer do you have to rebuild the transmission?
How much money can you pay to bring 2 guinea pigs on a plane?
Which was the shortest month of 1988?
What is the Latin name for a house cat?
Where are beam bridges located in the world?
What is rai English?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
What we breathe?
On a 69 Pontiac GTO does the vacuum for distributor come from above or below the throttle plates?
0.9 dm how many mm?
Does Jimmy Swaggart own real estate?
Does salmon give birth to young alive?
In a 1998 Nissan Sentra when you turn the steering wheel to the left or close the driver's side door the horn goes off what causes this?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.