0
What else can I help you with?
Related Questions
When was Mario Pisu born?
Mario Pisu was born on May 21, 1910, in Montecchio Emilia, Italy.
When did Mario Pisu die?
Mario Pisu died on July 17, 1976, in Velletri, Italy of cerebral hemorrhage.
How tall is Raffaele Pisu?
Raffaele Pisu is 5' 11".
How tall is Mario Cimmaro?
Mario Cimmaro is tall 1.79
When was Max Pisu born?
Max Pisu was born on January 23, 1965, in Legnano, Lombardy, Italy.
What actors and actresses appeared in Acqua e chiacchiere - 1963?
The cast of Acqua e chiacchiere - 1963 includes: Ave Ninchi Mario Pisu Pina Renzi
Where is pisu language used in India?
There is no language in India called Pisu.There is a lake in Liberia called Lake Pisu.
When was Raffaele Pisu born?
Raffaele Pisu was born on March 24, 1925, in Bologna, Emilia-Romagna, Italy.
What actors and actresses appeared in Primo premio - 1970?
The cast of Primo premio - 1970 includes: Cinzia Bruno Dario De Grassi Olga Gherardi Mario Pisu
How tall is super Mario from super Mario?
Mario is 169cm
how tall are Mario characters?
Not very tall
How tall is Mario Andresol?
Mario Andresol is 6'.
Trending Questions
How do you replace the EGR on a Chevy Tracker?
How do you install intagram?
What was the name of James Watt's father?
Which of the foefollowing not considered an antigen-presenting cell?
Who was the first deputy marshall on Gunsmoke?
Egg's functions and its neutrients?
Describe the search for peace in the 1920s and its results?
What is the measure of an exterior angle of a 25 sided polygon?
Is 3km longer than 2900m?
Who is on of the Texas state's us Senators now?
What is hackensack?
What is the circumference of a circle with a diameter of 5m in terms of pi?
Who developed the Hangul writing system?
What is systalic and diastalic?
Is one half large than one frouth?
What is 9 divied by 3593?
How much money is 14k gold worth?
What is a common obstacle that keep soldiers from receiving mental health assistance?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is the definition of low sugar?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.