0
What else can I help you with?
Related Questions
When was Milissa Sears born?
Milissa Sears was born on April 6, 1981, in Barrington, Illinois, USA.
How tall is Milissa Imperial?
Milissa Imperial is 5' 3".
What movie and television projects has Milissa Sears been in?
Milissa Sears has: Played Amanda in "Criminal Minds" in 2005. Played Nervous Girl in "The Iron Man" in 2006. Played Mary in "Let Some Air In" in 2006. Played (segment "Jealousy Rides With Me") in "Directions" in 2006. Played Audrey in "Masters of Sex" in 2013.
What is the birth name of Milissa Imperial?
Milissa Imperial's birth name is Milissa Rose Imperial.
Who is Milissa Rehberger romantically involved with?
It is not known who Milissa Rehberger is romantically involved with. Milissa is a TV journalist on MSNBC news.
What nicknames does Milissa Imperial go by?
Milissa Imperial goes by Melly Mel, and Milli.
Is Milissa Rehberger married?
No. yes, to me
How tall is Kenneth Sears?
Kenneth Sears is 6'.
How tall is Ann Sears?
Ann Sears is 5' 5".
How tall is Christiane Sears?
Christiane Sears is 5' 7".
How tall is Jennifer Sears?
Jennifer Sears is 5' 5".
How tall is Thom Sears?
Thom Sears is 5' 10".
Trending Questions
What is an example of paradoxes?
What part of an element determines its ability to combine with other elements?
How do you Manage copper levels in a hot tub?
Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person?
What kinds of credit cards allow one to apply online?
What should I do if my dog is tired and has a dry nose?
2 cups is equal to how many ml's?
50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution?
Who was Athena' rival in the city-state?
What is a recipe from colonial Rhode Island?
Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK?
What is P0153 codes on Toyota Sienna 3.0 engine?
Which concept did the Maya understand before europeans?
What is 12times 8?
Does Jon Gruden still get paid from the buccaneers?
How can I find a replacement head for my Kobalt weed eater?
Why is my kitten growling while playing?
How do you define global environmental scan.?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What happened to st therese of lisieux when she was 4?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.