answersLogoWhite

0

How tall is Natascha Hirthe?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Natascha Hirthe is 172 cm.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Natascha Hirthe born?

Natascha Hirthe was born in 1968, in Berlin, Germany.


What movie and television projects has Natascha Hirthe been in?

Natascha Hirthe has: Performed in "Tatort" in 1969. Played Tanja Tosolini in "Die Drei" in 1996. Played Eva Henrich in "In aller Freundschaft" in 1998. Played Brigitte in "Die Rettungshunde: Hochzeitsreise in den Tod" in 2003. Played Luise Richter in "Typisch Sophie" in 2004. Played Jugendamtsmitarbeiterin in "Klinik am Alex" in 2009.


How tall is Natascha Romano?

Natascha Romano is 162 cm.


How tall is Natascha Bessez?

Natascha Bessez is 5' 8".


How tall is Natascha Bub?

Natascha Bub is 174 cm.


How tall is Natascha Hockwin?

Natascha Hockwin is 163 cm.


Is Natascha McElhone tall?

Natascha McElhone is 5' 8".


How tall is Natascha Snellman?

Natascha Snellman is 5' 4 1/2".


How tall is Natascha Kampusch?

Natascha Berg is 5' 8 1/2".


When was Martin Hirthe born?

Martin Hirthe was born on February 13, 1921, in Berlin, Germany.


When did Martin Hirthe die?

Martin Hirthe died on August 19, 1981, in West Berlin, West Germany.


What is the birth name of Natascha Graf?

Natascha Graf's birth name is Natascha Aghfurian.

Trending Questions
How do you get relichant in Pokemon? British most wanted? How many grams is 4 cups of diced apples? What are the differences between water erosion and water deposition? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? How does the process of newborn skull development impact overall growth and development in infants? What causes a transaxle on my 2005 Ford Freestar to get hot? Who kills Alison in Pretty Little Liars? Are there any data free usage apps on iPhone? Different Types Of Arousal in sport? Where do toadfish live? How can you call the people on a congregation? How long does it take for a tree to fully be grown? When does Suburgatory season 2 come out on DVD? What is the mission statement for abbott labs? What was the delorian car made of? How much does a steinway d cost? How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L? How do you tell how old a terrapin is? What is 4198 to the nearest 100?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.