0
What else can I help you with?
Related Questions
When was Sascha Ley born?
Sascha Ley was born on September 13, 1967, in Saarbrcken, West Germany.
How tall is Sascha Saballett?
Sascha Saballett is 6'.
How tall is Sascha Kurth?
Sascha Kurth is 6'.
How tall is Sascha Schiffbauer?
Sascha Schiffbauer is 185 cm.
How tall is Sascha Sin?
Sascha Sin is 165 cm.
How tall is Sascha Rosemann?
Sascha Rosemann is 187 cm.
How tall is Sascha Zaglauer?
Sascha Zaglauer is 176 cm.
How tall is Sascha Tschorn?
Sascha Tschorn is 168 cm.
How tall is Sascha Turnheim?
Sascha Turnheim is 5' 11".
How tall is Sascha Biesi?
Sascha Biesi is 5' 3".
How tall is Sascha Brungs?
Sascha Brungs is 195 cm.
How tall is Sascha Posch?
Sascha Posch is 181 cm.
Trending Questions
What is the full form for SHEM?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How does jem try to make scout feel beter after he conversation with aunt alex andra?
How much does an ounce of lawrencium cost?
What is ducktape for?
Who is martinique president?
What red gemstones can one have set in a ring?
What muscles are used doing the splits starting from standing?
What is the land area from which a stream gets water?
What is it like at Mecca?
Why does Douglass believe that people should be allowed to move freely from one country to another?
How do you use boilerplates?
What does the idiom 'In black and white' mean?
How do you put aerobe in a sentence?
What is the cost for a valve job on a 1999 GMC suburban?
Why do AC lines freeze up and how can this issue be prevented?
How many credits will FAFSA pay for?
Is France a European country?
What is the Japanese word for rabbit?
In badmintion what is a powerful downward stroke?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.