0
What else can I help you with?
Related Questions
What is the birth name of Tracie Thoms?
Tracie Thoms's birth name is Tracie Nicole Thoms.
What is Tracie Thoms's birthday?
Tracie Thoms was born on August 19, 1975.
When was Tracie Thoms born?
Tracie Thoms was born on August 19, 1975.
How old is Tracie Thoms?
US actress Tracie Thoms is 41 years old (birthdate: August 19, 1975).
Is tracie thoms still on cold case?
yes
Is Tracie Thoms gay?
Who cares maybe by asking one might find it getting closer to what excites them!
How tall is Tracie Nealy?
Tracie Nealy is 5' 5".
How tall is Tracie Jules?
Tracie Jules is 5' 4".
How tall is Tracie Hansen?
Tracie Hansen is 5' 3".
Who is the black actress in the McDonald's commercial where the husband is just getting his money's worth?
Tracie Thoms - actress in rent and Cold Case
Which roles are Tracie Thoms best known for?
Tracie Nicole Thoms is a television, stage and film actress. She is best known for her stage role, playing Joanne Jefferson in the musical Rent. She is also known for her roles in the television series Cold Case and Wonderfall. She has also had notable roles in the Devil Wears Prada and Death Proof.
How tall is Tracie Trixx?
traci braxton is 5''3
Trending Questions
What document approved by 13 states was established the first government in 1781?
Longest wavelength in the spectrum of color?
What was the most important medium for Tin Pan Alley songs at the turn of the Century?
What does the name Safora mean?
What is the definition of a quarter moon?
What is the centre of culture?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
Who was the commanding officer union during the battle of Gettysburg?
Is the radium Paint in a compass dangerous?
How do you pronounce the brand of sunglasses called Costa?
Did the Philippines fight in World War 2?
Hindu goddess of the Earth?
What could be considered a reliable source of scientific information?
How did rev run and kid rock become friends?
Which dosage is stronger 160 mcg or 220 mcg?
Who said liberty consists in doing what one desires?
Which religious group primarily settled in Pennsylvania?
How do you get off the help menu pokemon fire red pc?
Can Catholics be single?
Why is there no power to the ignition switch?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.