answersLogoWhite

0

How tall is calloway?

User Avatar

Nathaniel Lebsack ∙

Lvl 10
∙ 5y ago
Updated: 4/29/2021

Cab Calloway is 5' 10".

User Avatar

Josefina Kunze ∙

Lvl 10
∙ 4y ago
Copy

What else can I help you with?

Related Questions

How tall is Cab Calloway?

Cab Calloway is 5' 10".


How tall is Christian Calloway?

Christian Calloway is 5' 11".


How tall is Jordan Calloway?

Jordan Calloway is 5' 11".


How tall is Kiyomi Calloway?

Kiyomi Calloway is 5' 4".


How tall is Northern Calloway?

Northern Calloway is 5' 11".


How tall is mark calloway?

6 ft 10 i think


How tall was Cab Calloway?

Five foot seven. Five foot seven.


What are baseball player Ron Calloway's physical stats?

Ron Calloway is 6 feet 1 inches tall. He weighs 210 pounds. He bats left and throws left.


Who did Cab Calloway get married to?

Zulme Calloway


What is the birth name of Cab Calloway?

Cab Calloway's birth name is Calloway III, Cabell.


What is the birth name of Northern Calloway?

Northern Calloway's birth name is Northern J. Calloway.


What is the birth name of Peter Calloway?

Peter Calloway's birth name is Peter Alexander Calloway.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.