0
What else can I help you with?
Related Questions
Is Rwanda a genocide?
No. Rwanda is a country where a genocide occurred in the 1990s.
Was anyone punished for the Rwanda genocide?
no their was no one who got punished for the Rwanda genocide.
Was Rwanda governmentally organized during the Genocide?
Was Rwanda governmentally organized during the Genocide?
Where is genocide?
Rwanda
What country ended the genocide in Rwanda?
Rwanda itself!
Where is genocide active?
rwanda
What is a video about genocide?
Hotel Rwanda is a 2004 movie starring Don Cheadle that's about the 1994 Spring genocide in Rwanda.
Which regions have been the sites of genocide or attempted genocide in the 20th century?
turkey Germany Rwanda
What genocide occurred in 1990 in Rwanda?
The Rwandan Genocide occurred in 1994
Who were the aggressors in the Rwanda genocide?
The Hutus
What began the Rwanda genocide?
The killing of the Rwanda president , but the Hutu were the ones that killed the president but many believed it was the tutu-sis. S o that's what began the Rwanda genocide.
Where did the Rwanda genocide take place and when?
The genocide in Rwanda recently occurred in 1994 and about 500000 people were killed.
Trending Questions
How do you replace the EGR on a Chevy Tracker?
How do you install intagram?
What was the name of James Watt's father?
Which of the foefollowing not considered an antigen-presenting cell?
Who was the first deputy marshall on Gunsmoke?
Egg's functions and its neutrients?
Describe the search for peace in the 1920s and its results?
What is the measure of an exterior angle of a 25 sided polygon?
Is 3km longer than 2900m?
Who is on of the Texas state's us Senators now?
What is hackensack?
What is the circumference of a circle with a diameter of 5m in terms of pi?
Who developed the Hangul writing system?
What is systalic and diastalic?
Is one half large than one frouth?
What is 9 divied by 3593?
How much money is 14k gold worth?
What is a common obstacle that keep soldiers from receiving mental health assistance?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is the definition of low sugar?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.