0
What else can I help you with?
Related Questions
When was Unilever created?
Unilever was created in 1930.
When was Unilever House created?
Unilever House was created in 1933.
When was Unilever Indonesia created?
Unilever Indonesia was created in 1933.
When was Unilever Pakistan created?
Unilever Pakistan was created in 1948.
When was Hindustan Unilever created?
Hindustan Unilever was created in 1933.
When was Unilever Ghana created?
Unilever Ghana was created on 1992-07-14.
When was Unilever Australasia created?
Unilever Australasia was created in 1930 when the Lever Brothers and Margarine Unie merged their existing operations in New Zealand and Australia.
What is the population of Unilever?
Unilever's population is 171,000.
What is the punchline of Hindustan Unilever?
Unilever's mission is to "Add Vitality to life." See the link below for Hindustan Unilever.
Why did Unilever set up Unilever Merseyside Ltd?
You may contact Unilever at: Unilever UK is located at 100 Victoria Embankment, Blackfriars London 94111. or their website on the link below.
What is Hindustan Unilever's population?
The population of Hindustan Unilever is 2,011.
What is the population of Unilever Australasia?
The population of Unilever Australasia is 1,600.
Trending Questions
Top school in Karachi?
What happen when you mix Robitussin an sprite?
What team holds the record for the most turnovers in an NFL game?
Were australians for or against World War 1?
Who wrote thatpeople can and should govern themselves?
What professional group governs the Central Reserve Depository Institutions?
What is the Politically correct way of saying deaf?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What was it about Franklin Delano Roosevelt that stunned Stalin and Churchill at the Yalta Conference in February of 1944?
Is happy hour at sonic everyday?
In a life estate does the owner of real property still own the property if he has quit claimed the property to the remaindermen?
Advantages of capital from profits?
Will a penny rust in apple juice?
What is a pooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo?
Komodo dragon is a snake true or false?
How much does it cost to service jet engine?
What is the processor executes instaction frequency?
Can you provide some melodic dictation examples for practice?
What is semto?
What are the important aspects of a responsible citizenship in education?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.