0
What else can I help you with?
Related Questions
When the world going to enf?
It's going to end on Dec 21/27/2012. But don't think it's true because no one knows for sure. Many people think the world is going to end in 2012, but I don't think so. Try to live happy don't worry anythings else:-)
What is the abbreviation for enforcement?
Enf
Will the world really explode in 2012?
no
Will the world really go in 2012?
no because how is there going to be another world
What were air raids and why were they so dangerous?
enf v
Is the end of the world really going to happen on December 21 2012?
No it is not so do not panic,the world will not end in 2012.
Is really end this world in Dec 21 2012?
No.
How did you know that in 2012 there will be end of world?
Nobody really knows for certain when the end of the world will be. But it probably will not be December 21, 2012.
Do you REALLY think that the world is going to End in 2012?
yes
Is the myth that the world will come to an end in 2012 really true?
No!
Is the world really going to end December 21 2012?
No, the world didn't end.
Is the world really going to end on Sunday December 23 2012?
no
Trending Questions
Calculate the molarity of a H3PO4 solution of 6.66 in 555mL of solution?
What are treatments for splenic trauma?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Does logh mean forgive in Gaelic?
What is the collect noun for tools?
Are phoenix university credits transferable?
Where is the Unitarian Universalist Church located?
How much solar energy reaches Earth?
What is a female monk called in the Chinese language?
Which theme can be found in both If and The Jungle Book by Rudyard Kipling?
Where is the habitat of Rhizomes?
How much are ballet point shoes at a dance school?
Is 0.323232 rational?
What did George Washington say?
What steps can use to protect yourself from cybercrime?
The three states of matter are?
Is the setting in England for James and the Giant Peach?
Was Australia called Australia in 1901?
Sleepover games for 18 year olds?
What is the denominator of fraction?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.