0
What else can I help you with?
Related Questions
Are Dolly Parton and Miley Cyrus related?
Dolly Parton is Miley Cyrus' Godmother but they are not blood related.
Is Trish Cyrus related to Miley Cyrus?
She's Miley's mum!
Is Kurt Cyrus related to Miley Cyrus?
No.
Is Miley Cyrus and Jackson on the show Hannah Montana related for real?
No Miley Cyrus and Jackson are not related at all
Is director Kelly Cyrus related to Miley Cyrus?
Yes, director Kelly Cyrus is related to Miley Cyrus; she is Miley's aunt. Kelly is the sister of Miley's father, Billy Ray Cyrus. This connection highlights the close-knit nature of the Cyrus family in the entertainment industry.
Is pete Cyrus related to Miley Cyrus?
YES
Is Craig Mabbit related to Miley Cyrus?
Yes because he is the HALF brother of Miley Cyrus and Braison Cyrus.
Is bambi cyrus related to miley?
Bambi is Miley's Cousin
Is Dawn in Pokemon related to Miley Cyrus?
They are not related.
Is Lady Gaga and Miley Cyrus related?
NO, they are not related.
Is Billy Rae Cyrus related to Dolly Parton?
No. But Dolly Parton is Miley Cyrus's godmother (miley is Billy Ray Cyrus's daughter)
What music artist played a part in a movie or television show?
Miley Cyrus, Christina Aguilera, Cher
Trending Questions
How do you get relichant in Pokemon?
British most wanted?
How many grams is 4 cups of diced apples?
What are the differences between water erosion and water deposition?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
How does the process of newborn skull development impact overall growth and development in infants?
What causes a transaxle on my 2005 Ford Freestar to get hot?
Who kills Alison in Pretty Little Liars?
Are there any data free usage apps on iPhone?
Different Types Of Arousal in sport?
Where do toadfish live?
How can you call the people on a congregation?
How long does it take for a tree to fully be grown?
When does Suburgatory season 2 come out on DVD?
What is the mission statement for abbott labs?
What was the delorian car made of?
How much does a steinway d cost?
How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L?
How do you tell how old a terrapin is?
What is 4198 to the nearest 100?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.