0
What else can I help you with?
Related Questions
How does Rick Riordan promote his books?
Rick riodan is the author
Were does rick riodan live?
San Antonio, Texas
When will rick riodan start the new series?
2010 i believe
How does rick riodan get his intreset for his books?
ask him on his website rickriordan.com
Who is Rick riodan?
He is the person who wrote the Percy Jackson and the Olympians series.
Is Rick riodan an atheist?
Don't know, I have not read as such. This is a question for celebrities.
What was rick riodan do for a job?
I believe he was a teacher of Mythology before becoming a writer
Where can you fine free rick riodan books?
at any bookstore, or websites such as amazon or scholastic.
What is the ending to the book The Lightning Thief by Rick Riodan?
Luke betrayes and tries to kill Percy
Where can you find the lost hero by rick riodan?
At any major bookstore on October 12th 2010
When will rick riodan finish the new Olympians series?
The first book will be released near the end of 2010.
How popular is the Rick Riodan lost hero?
this is how ill describe it harry potter popular that's a lot
Trending Questions
Is there a recall on 2006 PT cruiser?
Where do you go to get a permit to put up a fence in LA?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp?
Which Ohio State Football player is called Animal?
Worsted system and woolen system?
What is another name for a tire's height?
How many days old are you today if you were born March 8 1949?
Is ohm's law applicable to ac or dc and why?
Son and daughter of Ferdinand Magellan?
How big is Selena gomez's mole?
What is the value of a 2003 US dollar coin?
Animals in trenches?
Does Minnesota have tolls on its roads?
What is 147 square feet converted to square meters?
Is this statement true premiums for term life insurance decrease as people get older?
What should I do if my toilet has a weak flush?
When was Mann Kee Awaaz Pratigya created?
What is the recipricol of 7654321?
What is the unit price of a product?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.