0

Is a grasshopper's a consumer OR a producer?

Anonymous

∙ 7y ago

Updated: 8/24/2021

A grasshopper is a consumer.

Abbigail Waelchi ∙

Lvl 10

∙ 4y ago

What else can I help you with?

Related Questions

Is a grasshopper a producer consumer or decomposer?

Grasshoppers are consumers.

Is a grasshopper a consumer producer or a decompose?

Grasshoppers are consumers.

Is a grasshopper a consumer producer or decomposers?

Grasshoppers are consumers.

Is a grasshopper a consumer, producer, or decomposed?

Grasshoppers are consumers.

Is a sparrow a producer or a consumer?

A consumer. A heterotroph.

Is a grasshopper a producer consumer decomposer?

a decomposer

Is a grasshopper an consumer?

Consumer because it doesn't make it's own food as a producer would(ex.plant)

Why are grasshoppers identifited as first-order consumers?

Its not god

Is a pollack a producer or consumer?

is a pollack a producer, or a consumer

Is a slug producer or consumer?

It is a consumer.

Is a rosette plant a producer or consumer?

no

What is a plant that is a consumer?

Grasshoppers

Trending Questions

Choose the connective that belongs in the blank in the following sentence you like to play baseball you cannot throw a ball very well a however b in fact c. for instance c. besides? Is epoxy dishwasher safe? Is Caroline costa and Abraham mateo dating? Werere can you get pictures of sakura kinomoto tied up in rope tape gagged and beer feet and skaura chair tied gagged and get her toes and feet tickled and sakura traped in a net and skaura warpped up? How many children did Queen Elizabeth mum have? Is colombia the largest spanish speaking country in south america? What examples of ethnocentrism are there in healthcare? Is the square root of 22 irrational or rational? Can you leave a spoon in food in the refrigerator over night and still eat it? How much oil is in a 2002 Kia Rio? Is colony farm pond frozen in the winter? Who was a one legged sailor with a parrot? What is the ampere of split type air con? How many times does 13 go into 74? When the product of 10 and 15 is divided by the sum of 10 and 15 what is the quotient? Is the virtue of courage enable one to face danger? How many percent you pay for federal taxes and state taxes on IRA rmd? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What is a picture that exaggerates a person's features? What is the use of a sewing machine?

Resources

Top Categories

Product

Company

Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.