0
What else can I help you with?
Related Questions
Is VDU hardware or software?
A VDU is hardware.
Is scanner a hardware or software?
A scanner is both hardware and software, the device itself is hardware (all devices are hardware) but the driver(a program) that runs it is software.
Is RAM software or hardware?
hardware
Is a microphone a hardware or software?
A microphone is hardware. Software is what programs and games are called.
Is the motherboard hardware or software?
Motherboards are hardware components, not software.
What was first software or hardware?
Have to be hardware. How could you write software if there were no hardware to write it on?
Is a computer a software of hardware?
both a hardware and software
Why is hardware needed in a computer?
Software. Short and sweet. Hardware needs software to work.
Is webcam a hardware or software?
hardware
Is hardware tangible and software intangible?
Yes. Hardware can be touched and software cannot.
Is a scanner hardware of software?
A scanner is a hardware device that is operated by software.
What is the principle of Equivalence of Hardware and Software?
anything that can be done with hardware can also be done with software and anything done with software can also be done with hardware.
Trending Questions
How do you replace the EGR on a Chevy Tracker?
How do you install intagram?
What was the name of James Watt's father?
Which of the foefollowing not considered an antigen-presenting cell?
Who was the first deputy marshall on Gunsmoke?
Egg's functions and its neutrients?
Describe the search for peace in the 1920s and its results?
What is the measure of an exterior angle of a 25 sided polygon?
Is 3km longer than 2900m?
Who is on of the Texas state's us Senators now?
What is hackensack?
What is the circumference of a circle with a diameter of 5m in terms of pi?
Who developed the Hangul writing system?
What is systalic and diastalic?
Is one half large than one frouth?
What is 9 divied by 3593?
How much money is 14k gold worth?
What is a common obstacle that keep soldiers from receiving mental health assistance?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is the definition of low sugar?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.