0
What else can I help you with?
Related Questions
Which is smaller a cup or liter?
a cup 1 liter = 4.22 cups 1 cup = 0.23 L 1 L = 4 metric cups
How many liter make one cup?
A liter. Be it coffee, tea, urine, or vacuum, a liter of anything is a liter. If you're looking for prices, a liter is slightly smaller than two Starbucks venti cups, so about $4.50 US.
Does a liter equal a cup?
No 1 liter = 4.22 cups 1 cup = 0.23 liter
What is smaller than a liter?
a milliliter is smaller than a liter
What is smaller than a liter but larger than a milliliter?
A centilitre or a decilitre, pint, quart, dram, ounce, tablespoon, teaspoon, cup...
How many cup is 47 liter?
198.65 cups 1 liter = 4.22 cups 1 cup = 0.23 liter
Which is smaller liter or killiliter?
A killiliter is 1000 liters, so a liter is smaller
How many liters is one cup and a quarter?
0.29 liter 1 liter = 4.22 cups 1 cup = 0.23 liter
How much smaller is a milliliter from a liter?
A milliliter is 1000 times smaller than a liter.
1 cup is how much liter?
1 liter = 4.22 cups 1 cup = 0.23 liter
How many ounces are in a cup and in a liter?
1 cup 8 oz 1 liter 33.81 oz
How many cups make 2 liters?
8.45 cups 1 liter = 4.22 cups 1 cup = 0.23 liter
Trending Questions
Does Zipporah And Moses Ever Have A Child?
How does the size of the moon compare to the size of the Earth?
What is a gas furnace and its advantage?
Where is the thermostat located on a 1992 Cadillac Seville?
Is this a tear and tears homophone or homograph?
What year was Henry viii became king of England?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What county is shannon airport in?
Where are plastic bottles assembled?
How many years does a felony show up on a background check in AZ?
Are rhinoes cold blooded or warm blooded?
What was the name of the 282 laws that were established by king Hammurabi?
What do the markings on the side of a B-52 mean?
How can you locate your towed car?
When did Alexander MacDonald Shook die?
Why did the colonial times need surveyors?
Does beef jerky have worms?
Is a wolf spider bite dangerous and what are the potential risks associated with it?
Is dbz infinite world on xbox 360?
Are plastic bags toxic?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.