0
What else can I help you with?
Related Questions
What is the birth name of Nadine Coyle?
Nadine Coyle's birth name is Nadine Elizabeth Louise Coyle.
What is Nadine Coyle's full name?
Nadine Elizabeth Louise Coyle
How much does nadine coyle weigh?
Nadine Coyle is a singer-songwriter, actress and model who was born in Londonderry, UK, on June 15, 1985. Nadine stands 1.65 cm tall and is said to weigh 45 kg.
How old is Nadine Coyle?
Nadine Coyle is 32 years old (birthdate: June 15, 1985).
What is Nadine Coyle's birthday?
Nadine Coyle was born on June 15, 1985.
Is nadine coyle and kimberly coyle sisters?
no
What is Nadine Coyle's mum called?
Lillian coyle
Who is better out of cheryl cole and nadine coyle?
nadine coyle and cheryl cole are both gr8 singers
Who is nadine coyle related to?
no...................
Are Charlotte Coyle and Nadine Coyle sisters?
No, she has sisters Charmaine and Rachael
When did Nadine Coyle get the shingles?
2008
Is nadine coyle irish?
yes :)
Trending Questions
Where is the Ferrari car manufactured?
Why are my lifters tapping after flood water was drained from the engine and the oil has been changed?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Did Alexander Fleming do bad?
What is the meaning of game over?
What is 390.98 rounded to the nearest square meter?
What are intercalated disks?
Why do you think graphs are a useful way to display information?
Who is lyasan utyasheva?
What objects in outer space can hit earth and cause major damage to earth?
Why do Tamils wear dhotis?
How much is yu gi oh card number 39 utopia worth?
How much should you feed your 30 lb dog?
How much does an aircooled vw engine weigh?
What are organisation management and technology dimensions of information systems?
How many miles from Houston TX to Franklin TN?
What is the correct spelling for Best friend?
What is weight of pressure treated 12 x 12 piling?
Why are my tomato plant leaves drooping and curling?
What is the process that produces starch from the leaves?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.