0
The rapper Pusha T is 5'8" (173 cm).
What else can I help you with?
Related Questions
How tall is Pusha T?
The rapper Pusha T is 5'8" (173 cm).
When was Pusha T born?
Pusha T was born on May 13, 1977
When is Pusha T's birthday?
Pusha T was born on May 13, 1977
What is the birth name of Pusha T?
Pusha T's birth name is Terrence Thornton.
What is Pusha T's occupation?
Pusha T is a/an Rapper,songwriter,record executive,"pushacomplex",
Does Pusha T have children?
Pusha T or Terrence Thornton is a rap singer. He does not currently have any children.
Does Pusha T have any children?
Pusha T or Terrence Thornton is a rap singer. He does not currently have any children.
Is pusha t a blood?
no he not a blood
What are the release dates for RapFix Live - 2010 Pusha T 1-12?
RapFix Live - 2010 Pusha T 1-12 was released on: USA: 18 November 2010
How much money does pusha t have?
Net worth is 15 million
What are the release dates for Ben Baller - 2012 Pusha T's Benz Chain 1-1?
Ben Baller - 2012 Pusha T's Benz Chain 1-1 was released on: USA: 26 September 2012
What are the release dates for RapFix Live - 2010 2 Chainz Pusha T Tech N9ne August Alsina Cap 1 and E-Sud 5-4?
RapFix Live - 2010 2 Chainz Pusha T Tech N9ne August Alsina Cap 1 and E-Sud 5-4 was released on: USA: 5 February 2014
Trending Questions
Can a parent kick you out if you are over the age of 18?
What is the Gosselin family's political affiliation?
How tall is Radhaa Nilia?
What level does lombre learn fake out?
Which of the following is NOT one of the so-called pillars of primary health care as outlined by the Declaration of Alma Ata?
What are animal claws used for?
What is the distance between two longitudes at the equator?
Does ingrown toenail surgery hurt?
When was Black dress of Rita Hayworth created?
Who does Mr Pilkington represent in Animal Farm?
Is the moon made out of sand?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What if caffeine does not have an effect on you?
What is the definition of futile?
Why is there an Australian midget pooping in your attic?
How much does a cintas ssr make?
Michael's Coupons?
What does miogynistic mean?
What are three examples of governmental actions that might interfere with free market?
What are the 4 major civic duties?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.