answersLogoWhite

0

Is the Hunger Games on graboid?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/20/2019

yes there is

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What is the first hunger games film called?

The Hunger Games


How do you start a new account with graboid?

You can get free graboid account from the related link.


What is the best hunger games book?

The Hunger Games :)


What event is today hunger games?

The Hunger Games


What do the characters do in Hunger Games?

Play Hunger Games


What is the oringnal name for the Hunger Games?

Hunger Games........


Is the Hunger Games or The Hobbit better?

hunger games


What is the difference between The Hunger Games and The Hunger Games classic?

There is no difference. Actually, there is no such thing as "The Hunger Games Classic".


What is a cereal name for the Hunger Games without using hunger?

The Food games The death games the fighting games Or the appetite games


What did Gale wear in the Hunger Games?

Gale was not in the Hunger Games Katniss and Peeta where.


What does hunger have to do in the Hunger Games book?

Hunger is in Hunger Games because the tributes starve and get not much food so they are really hungry. Then if they win the Hunger Games, they can have as much food as they want.


How many words are hunger games?

2, hunger and games

Trending Questions
What size wire is needed for 15 amps over a distance of 300 feet? Are how to have a mermaid baby? How to reset jaguar fail safe? Does royal gelatin jello have pig fat? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? Will headers get the starter hot so the car won't crank? How can I effectively glue rattan to wood? What does mean when he ask you ask? Where does Guano originate from? To Hrothgar was given such glory of war such honor of combat that all his kin obeyed him gladly till great grew his band of youthful comrades infers? Is there an Altaic language family? Why do ecologists ask questions about events and organisms that range in complexity from an individual to the biosphere? What kind of root and venation does bean have? If a box had to be 200 cubic inches what size would it have to be in standard inches? What is the least common multiplus of 21? Why is your 1982 Ford Bronco hard to start? How much is the frank thomas baseball card worth? Can you get introuble if someone is underage drinking at your house and you have a sign up? Is it possible for a guy who turned you down to still be jealous when he knows there is another guy in your life? What is that song on the movie igor talking about big girls?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.