0
What else can I help you with?
Related Questions
Is the ice water in the north pole sweet?
No, ice water at the North Pole is not sweet. It is made up of frozen seawater, which does not contain any sugar or sweetness.
How is the North Pole formed?
The North pole is not made by santa
What kind of water does Mars have?
Frozen water ,there is one ice cap at the north pole and a cap at the south pole made up of frozen gases.
Who has made it to the north pole?
I did make it to the north pole and I will show you a picture
What is the North Pole made of on Mars?
There isn't a north pole on Mars.
What has land under it the north pole or the south pole?
The South Pole has land under it, the North Pole only has water.
What body of water surrounds the north pole?
The Arctic Ocean covers the magnetic North Pole
Is the north pole under water?
no, but it is on top of the water
If you were in new york city would you be closer to the north pole or equator?
there is no such thing as the north pole...its water....
Which pole has water under it the North Pole or the South Pole?
You can locate the North Pole on the Arctic Ocean sea ice.
What are the difference between the north and south poles?
The north pole is over water and the south pole is over land.
How cold is the water in the north pole?
-1.8C
Trending Questions
What layer of the earth that Metal of this region are squeezed tight due to great pressure?
What term describe people leaving farm to live and work in city?
What is surface complexation?
Who were melchior and casper?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How many 150 ml glasses in 4 litres of water?
Can you provide examples of IOUs and explain how they are typically used in financial transactions?
What was the most powerful ancient country?
What happens at the end of the book Scat?
What is the quotient of 4 and 82?
What are the most effective exercises to target the abs using an exercise ball?
Where did the plague begin and how was the plague spread from place to place?
Did Bruce Lee fight a demon?
How tall is Nunziatina Vitanza?
Does sterling knight kissed Selena Gomez?
What actors and actresses appeared in Obake no Q-taro - 1965?
How can you remove scale floating around and blocking your faucets?
Which is true about the effect farming has on erosion?
When was Grant Ibbs born?
What not to mix with anitripyline?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.