0
What else can I help you with?
Related Questions
Is orange juice a acids alkali or neutral?
Yogurt is an acid. Because when you taste yogurt you get an acidy taste left in your mouth. There is also acid in yogurt.You spelled it wrong you ass, its under dairy products
Is yogurt a alkali or acid?
Plain unflavored yogurt is mildly acidic.
Is water an acid or an alkali?
Water is neither acid or alkali it is neutral
Is sugar acid or alkali?
sugar is a acid when dipped or mixed in universal indicator...............
Is sugar alkali or acid or neutral?
Sugar is Neutral.
Is lemon juice an acid an alkali or neutral?
acid
Is vinegar a acid a alkali or a neutral?
Is vinegar a acid
Is lemon juice acid or alkali or neutral?
acid
Is salt a neutral acid or alkali?
Table salt is neutral.
Is Hydrogen oxide acid or alkali?
Hydrogen oxide is neither an acid nor an alkali. It is water, which is a neutral substance.
What is a chemical called which is not an acid or alkali?
A substance that is neither an acid nor an alkali is generally referred to as a neutral substance. Water is a common example of a neutral chemical compound.
Is water acid or alkali?
Water is neutral.
Trending Questions
What is the term used to describe the ratio of force and the area on which it acts?
Who was married to Joan Plowright?
How much is a heat lamp?
What pushes food through the small intestine?
Is a tsunami a single wave?
When did Congo Bongo happen?
What is the of human population?
If the torque converter goes bad on a 4x4 Chevy Blazer do you have to rebuild the transmission?
How much money can you pay to bring 2 guinea pigs on a plane?
Which was the shortest month of 1988?
What is the Latin name for a house cat?
Where are beam bridges located in the world?
What is rai English?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
What we breathe?
On a 69 Pontiac GTO does the vacuum for distributor come from above or below the throttle plates?
0.9 dm how many mm?
Does Jimmy Swaggart own real estate?
Does salmon give birth to young alive?
In a 1998 Nissan Sentra when you turn the steering wheel to the left or close the driver's side door the horn goes off what causes this?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.