0
What else can I help you with?
Related Questions
What is the legal age for owning a pet?
any age
Legal age for owning a rifle?
18
Is there a legal age to buy a car?
no there is no legal age to buy a car there is a legal age to drive though
What is legal age for owning a shotgun?
Unless your state has restrictions, 18.
Can you trade in your car if you don't have current registration on it?
No, because you can't show legal title to owning the car.
What is the legal age to buy a car in Wisconsin?
what is the legal age to buy a car in wisconsin ?
What is legal age to purchase a car in Massachusetts?
what is the legal age to purchase a car in massachusetts
What is the legal age to own a car in Alabama?
The legal age to own a car in the state of Alabama is 19.
What is the legal age to lease a car?
In most states, the legal age is 18.
What is the legal age to buy a car in Nebraska?
The legal age to sign a contract or purchase a car in Nebraska is 19. You can buy a car at a younger age if your parents sign the contract.
Is it legal to own a right side drive car in Pennsylvania?
There are no laws about owning or driving a right side drive car in any state of the US.
What is legal age in St of OR to buy car?
I belive the legal is is 18
Trending Questions
How do you get relichant in Pokemon?
British most wanted?
How many grams is 4 cups of diced apples?
What are the differences between water erosion and water deposition?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
How does the process of newborn skull development impact overall growth and development in infants?
What causes a transaxle on my 2005 Ford Freestar to get hot?
Who kills Alison in Pretty Little Liars?
Are there any data free usage apps on iPhone?
Different Types Of Arousal in sport?
Where do toadfish live?
How can you call the people on a congregation?
How long does it take for a tree to fully be grown?
When does Suburgatory season 2 come out on DVD?
What is the mission statement for abbott labs?
What was the delorian car made of?
How much does a steinway d cost?
How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L?
How do you tell how old a terrapin is?
What is 4198 to the nearest 100?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.