answersLogoWhite

0

Meaning of UN

User Avatar

Anonymous

∙ 17y ago
Updated: 8/16/2019

It means united nations

User Avatar

Wiki User

∙ 17y ago
Copy

What else can I help you with?

Related Questions

What is meaning of un?

if you mean the stem un-, then the meaning is not. As in unprofound, or unequal.


What is the meaning of un-?

if you mean the stem un-, then the meaning is not. As in unprofound, or unequal.


What does the suffix UN mean?

un- is usually a prefix meaning not


What is the meaning of jithin?

un defeatable


What is the root word of unmeaningful?

The root word of "unmeaningful" is "meaning." By adding the prefix "un-" to "meaning," we create the word "unmeaningful," which conveys the opposite of meaningful.


What is the prefix for conscious?

un-


What is an embalmer meaning in spanish?

Un embalsamador


What is the meaning of pro in school?

un lng


What is the prefix of unrepentant?

The prefix is "un" meaning "not"


What prefix is added to complete words?

un-


What is the meaning of solo un Leo?

The meaning of the phrase used by Barcelona F.C. and Argentina fans "Solo un Leo" is, There's only one Leo.


How does adding an un- to a word change its meaning?

Adding "un-" to a word typically adds a negative or opposite meaning to the original word. For example, adding "un-" to the word "happy" creates the word "unhappy," which means not happy.

Trending Questions
Can you plug in a mouse and a keyboard into PlayStation 3 and play? What is 31.6227766 rounded to the nearest thousandth? What is ICT Health and Safety? Did Victorian era kids play pin the tail on the donkey? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? If you miscarry how long will it take before a pregnancy test shows up negative? Car is jerking? Why do people tease blonde girls? How long can beer grain be stored and still be good for brewing? What is the ratio of the number of vowels to the number of consonants in the English alphabet? Will amtrak take me from Miami to Saint Augustine fl? You just accidentally took a swig of rubbing alcohol thinking it was water in a glass will a swig be cause for medical attention? What is the purpose of the active directory sites and services console? Where can I find a summary for the poem A Banished Wife's Complaint? Why do people shake hand with their right instead of left hand? Can bear kill people? Does common have children with eryka badu? How do you get a Dark Crystal in Maple story? Can you take Wellbutrin and bisoprolol together? Why is a thrust stage good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.